pCDNA3-FLAG-Regnase-3_1-244 aa
(Plasmid
#222659)
-
PurposeMammalian expression vector to express 1-244 aa of Regnase-3 tagged with FLAG at N-term
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 222659 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCDNA3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5432
- Total vector size (bp) 8160
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZc3h12c 1-244 aa
-
Alt nameMcpip3, Reg-3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2754
-
Mutationmutated asparagine 245 to a stop codon
-
Entrez GeneZc3h12c (a.k.a. A230108E06, C230027N18Rik, mKIAA1726)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA3-FLAG-Regnase-3_1-244 aa was a gift from Silvia Monticelli (Addgene plasmid # 222659 ; http://n2t.net/addgene:222659 ; RRID:Addgene_222659) -
For your References section:
Crosstalk between Regnase-1 and -3 shapes mast cell survival and cytokine expression. Bataclan M, Leoni C, Moro SG, Pecoraro M, Wong EH, Heissmeyer V, Monticelli S. Life Sci Alliance. 2024 Jun 3;7(8):e202402784. doi: 10.26508/lsa.202402784. Print 2024 Aug. 10.26508/lsa.202402784 PubMed 38830770