Skip to main content
Addgene

pUC57 mini-FLAG-HA-Regnase-3 WT
(Plasmid #222651)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 222651 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC57-mini-ZsGreen-P2A
  • Backbone manufacturer
    GenScript
  • Backbone size w/o insert (bp) 2283
  • Total vector size (bp) 4938
  • Modifications to backbone
    removed ZsGreen-P2A
  • Vector type
    in vitro transcription

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Zc3h12c
  • Alt name
    Mcpip3, Reg-3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2655
  • Entrez Gene
    Zc3h12c (a.k.a. A230108E06, C230027N18Rik, mKIAA1726)
  • Promoter T7
  • Tags / Fusion Proteins
    • FLAG (N terminal on backbone)
    • HA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsrGI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC57 mini-FLAG-HA-Regnase-3 WT was a gift from Silvia Monticelli (Addgene plasmid # 222651 ; http://n2t.net/addgene:222651 ; RRID:Addgene_222651)
  • For your References section:

    Crosstalk between Regnase-1 and -3 shapes mast cell survival and cytokine expression. Bataclan M, Leoni C, Moro SG, Pecoraro M, Wong EH, Heissmeyer V, Monticelli S. Life Sci Alliance. 2024 Jun 3;7(8):e202402784. doi: 10.26508/lsa.202402784. Print 2024 Aug. 10.26508/lsa.202402784 PubMed 38830770