pHIV-NAT-FLAG-CIP2A ∆NES (del561-625)
(Plasmid
#222625)
-
PurposeLentiviral vector that expresses Flag-tagged CIP2A NES mutant in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 222625 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepHIV-NAT-FLAG
- Backbone size w/o insert (bp) 7856
- Total vector size (bp) 10376
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNourseothricin (clonNAT)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCIP2A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2520
-
MutationDeletion of the residues 561-625 (ΔNES)
-
Entrez GeneCIP2A (a.k.a. KIAA1524, NOCIVA, p90)
- Promoter EF-1-alpha promoter
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer gcttggcacttgatgtaattctcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHIV-NAT-FLAG-CIP2A ∆NES (del561-625) was a gift from Daniel Durocher (Addgene plasmid # 222625 ; http://n2t.net/addgene:222625 ; RRID:Addgene_222625) -
For your References section:
The CIP2A-TOPBP1 axis safeguards chromosome stability and is a synthetic lethal target for BRCA-mutated cancer. Adam S, Rossi SE, Moatti N, De Marco Zompit M, Xue Y, Ng TF, Alvarez-Quilon A, Desjardins J, Bhaskaran V, Martino G, Setiaputra D, Noordermeer SM, Ohsumi TK, Hustedt N, Szilard RK, Chaudhary N, Munro M, Veloso A, Melo H, Yin SY, Papp R, Young JTF, Zinda M, Stucki M, Durocher D. Nat Cancer. 2021 Dec;2(12):1357-1371. doi: 10.1038/s43018-021-00266-w. Epub 2021 Nov 11. 10.1038/s43018-021-00266-w PubMed 35121901