pcDNA5-FRT/T0-Flag-BRIP1
(Plasmid
#222619)
-
PurposeMammalian expression vector of flag-tagged BRIP1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 222619 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepcDNA5 Flag-FRT-T0
-
Backbone manufacturerThermoFisher
- Backbone size w/o insert (bp) 5151
- Total vector size (bp) 8896
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBRIP1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3745
-
Entrez GeneBRIP1 (a.k.a. BACH1, FANCJ, OF)
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer cgcaaatgggcggtaggcgtg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5-FRT/T0-Flag-BRIP1 was a gift from Daniel Durocher (Addgene plasmid # 222619 ; http://n2t.net/addgene:222619 ; RRID:Addgene_222619) -
For your References section:
Genome-scale mapping of DNA damage suppressors through phenotypic CRISPR-Cas9 screens. Zhao Y, Tabet D, Rubio Contreras D, Lao L, Kousholt AN, Weile J, Melo H, Hoeg L, Feng S, Cote AG, Lin ZY, Setiaputra D, Jonkers J, Gingras AC, Gomez Herreros F, Roth FP, Durocher D. Mol Cell. 2023 Aug 3;83(15):2792-2809.e9. doi: 10.1016/j.molcel.2023.06.025. Epub 2023 Jul 20. 10.1016/j.molcel.2023.06.025 PubMed 37478847