Skip to main content
Addgene

pMRX-IZU-LAMP1-mRuby3
(Plasmid #222586)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 222586 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMRX-IP
  • Backbone manufacturer
    Dr.Shoji Yamaoka of Tokyo Medical and Dental University
  • Backbone size w/o insert (bp) 6137
  • Total vector size (bp) 7218
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    50-100 μg/mL
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LAMP1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1251
  • GenBank ID
  • Entrez Gene
    LAMP1 (a.k.a. CD107a, LAMPA, LGP120)
  • Tag / Fusion Protein
    • mRuby3 (C terminal on insert)

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer GGCATCGCAGCTTGGATACACGCC
  • 3′ sequencing primer GCACACCGGCCTTATTCCAAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMRX-IZU-LAMP1-mRuby3 was a gift from Noboru Mizushima (Addgene plasmid # 222586 ; http://n2t.net/addgene:222586 ; RRID:Addgene_222586)
  • For your References section:

    Syntaxin 17 recruitment to mature autophagosomes is temporally regulated by PI4P accumulation. Shinoda S, Sakai Y, Matsui T, Uematsu M, Koyama-Honda I, Sakamaki JI, Yamamoto H, Mizushima N. Elife. 2024 Jun 4;12:RP92189. doi: 10.7554/eLife.92189. 10.7554/eLife.92189 PubMed 38831696