TRE3GV-SpdCas9-Dnmt3A/3L-catΔ
(Plasmid #222508)

• Purpose: Expresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant catΔ (C706A and R832E) and hPGK promoter driven mCherry
• Depositing Lab: Isaac Hilton
• Publication: Guerra-Resendez et al ACS Synth Biol. 2025 Feb 3. doi: 10.1021/acssynbio.4c00569.

Backbone

• Vector backbone: LentiCRISPR v2
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: S. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant catΔ (C706A and R832E) engineered fusion
• Species: M. musculus (mouse), Synthetic; Streptococcus pyogenes
• Insert Size (bp): 5829
• Mutation: D10A and H840A in S.pyogenes Cas9; C706A and R832E in Dnmt3A
• Promoter: TRE3GV
• Tag / Fusion Protein:
  • FLAG Tag (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: accagtttactccctatcagtgata

Gene/Insert 2

• Gene/Insert name: mCherry
• Species: Synthetic
• Insert Size (bp): 708
• Promoter: hPGK

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: caatagcggctgctcagcaggg

Resource Information

• Supplemental Documents:
  • lenti_tre3gv_dcas9_dnmt3a3l_inactive-mutant_hpgk_mcherry.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry