pLN43 - pBait-1xMS2-7GC[chiP-5']-TtrpA
(Plasmid #222404)

• Purpose: arabinose-induced synthesis of a hybrid RNA containing a 5' MS2 hairpin, E. coli chiP 5'UTR insert between XmaI and HindIII sites, surrounded by a 7bp GC clamp, and followed by a 3' trpA terminator.
• Depositing Lab: Katherine Berry
• Publication: Linh D. Nguyen et al Sci Rep 15, 3820 (2025)

Backbone

• Vector backbone: pCDF
• Backbone size w/o insert (bp): 3933
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: 5’UTR of chiP (-98 to +12, relative to AUG)
• Species: E. coli
• Insert Size (bp): 107
• Entrez Gene: chiP (a.k.a. b0681, ECK0669, ybfM)
• Promoter: pBAD
• Tag / Fusion Protein:
  • 1xMS2 hairpin, 7GC clamp, TtrpA terminator

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XmaI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: CCGGTAACCCCGCTTATTAAAAGC
• 3′ sequencing primer: TATCAGACCGCTTCTGCGTTC

Resource Information

• Supplemental Documents:
  • pLN43_pBait_1xMS2_7GC[chiP-5']_TtrpA.gb
  • pLN43_pBait_1xMS2_7GC[chiP-5']_TtrpA.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry