Skip to main content
Addgene

pAF124
(Plasmid #222372)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 222372 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAF125
  • Backbone manufacturer
    Andrew S. Flies Lab
  • Vector type
    Mammalian Expression, Affinity Reagent/ Antibody
  • Selectable markers
    Hygromycin ; mTagBFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IGHG
  • Species
    H. sapiens (human)
  • Promoter EF1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcctcagacagtggttcaaag
  • 3′ sequencing primer aggcacagtcgaggctgat
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid generated by Gibson assembly using NotI and BsiWI sites.

Original reference for the sequence of the variable regions: Kaufmann et al. (2002) Crystal Structure of the Anti-His Tag Antibody 3D5 Single-chain Fragment Complexed to its Antigen. J Mol Biol. 318 (1):135-147. doi:https://doi.org/10.1016/S0022-2836(02)00038-4. PMID 12054774.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAF124 was a gift from Andrew S. Flies (Addgene plasmid # 222372 ; http://n2t.net/addgene:222372 ; RRID:Addgene_222372)
  • For your References section:

    Conversion of Mouse-Derived Hybridomas to Tasmanian Devil Recombinant IgG Antibodies. Slyp B, Darby JM, Flies AS. Methods Mol Biol. 2024;2826:231-249. doi: 10.1007/978-1-0716-3950-4_17. 10.1007/978-1-0716-3950-4_17 PubMed 39017897