prhaBAD-pA-Hia5
(Plasmid #222303)

• Purpose: Plasmid for rhamnose inducible expression and purification of protein A-Hia5-6XHis (pA-Hia5) for antibody directed DNA (adenine) methylation (as in DiMeLo-seq)
• Depositing Lab: Aaron Straight
• Publication: Altemose et al Nat Methods. 2022 Jun;19(6):711-723. doi: 10.1038/s41592-022-01475-6. Epub 2022 Apr 8.

Backbone

• Vector backbone: pd861-SR
• Backbone manufacturer: ATUM
• Backbone size w/o insert (bp): 2240
• Total vector size (bp): 3599
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pA-Hia5
• Alt name: protein A fusion to Hia5 DNA adenine methyltransferase
• Species: Haemophilus influenzae
• Insert Size (bp): 1359
• Mutation: codon optimized for bacterial expression
• GenBank ID: JF268249 AEV40923
• Promoter: rhaBAD
• Tags / Fusion Proteins:
  • protein A (N terminal on insert)
  • 6His (C terminal on insert)

Cloning Information

• Cloning method: Gene Synthesis
• 5′ sequencing primer: ATCTTTCCCTGGTTGCCAATGG

Resource Information

• Supplemental Documents:
  • prhaBAD-pA-Hia5.gbk
• A portion of this plasmid was derived from a plasmid made by: This plasmid was gene synthesized by ATUM.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry