pKL2299A
(Plasmid
#222105)
-
PurposeA ternary vir helper plasmid that carries Agrobacterium tumefaciens virulence genes for enhanced plant genetic transformation.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 222105 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepKL2299
- Backbone size w/o insert (bp) 29605
-
Vector typeBacterial Expression, Plant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namevirA
-
SpeciesAgrobacterium tumefaciens
-
Insert Size (bp)2490
-
GenBank IDAAZ50512.1
- Promoter virA promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGTTCGGTCAAGGTTCTGGA
- 3′ sequencing primer TTTCAACCAAACGACCGGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKL2299A was a gift from Kan Wang (Addgene plasmid # 222105 ; http://n2t.net/addgene:222105 ; RRID:Addgene_222105) -
For your References section:
Enhancing Agrobacterium-mediated plant transformation efficiency through improved ternary vector systems and auxotrophic strains. Aliu E, Ji Q, Wlazlo A, Grosic S, Azanu MK, Wang K, Lee K. Front Plant Sci. 2024 Jul 23;15:1429353. doi: 10.3389/fpls.2024.1429353. eCollection 2024. 10.3389/fpls.2024.1429353 PubMed 39109064