LHZ1494
(Plasmid
#222104)
-
PurposeTriple sgRNAs expression plasmid in Kluyveromyces marxianus.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 222104 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneKmARS1/CEN5
-
Vector typeYeast Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesg1RNA, sg4RNA, sg7RNA
-
gRNA/shRNA sequencesg1RNA: aattgggggaattataagcgt; sg4RNA: tagaaaaacagtagtggaagg; sg7RNA:gtacacagcattggaaatacc
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
sg1RNA targets position CP015059.1 (1,020,628..1,020,648) of K. marxianus ASM185444v2 genome assembly.
sg4RNA targets position CP015055.1 (601,263..601,283) of K. marxianus ASM185444v2 genome assembly.
sg7RNA targets position CP015057.1 (232,396..232,416) of K. marxianus ASM185444v2 genome assembly.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LHZ1494 was a gift from Yongming Wang (Addgene plasmid # 222104 ; http://n2t.net/addgene:222104 ; RRID:Addgene_222104)