Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pETSUMO2_Vitiosangium-bGSDM-thrombin
(Plasmid #222099)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 222099 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pETSUMO2
  • Total vector size (bp) 6736
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Vitiosangium-bGSDM-thrombin ORF
  • Species
    Vitiosangium sp. GDMCC 1.1324
  • Insert Size (bp)
    795
  • Mutation
    N-terminal methionine deleted and replaced by single serine scar after SUMO2 tag cleavage. Thrombin protease site replacing residues P234–M239.
  • GenBank ID
    WP_108071778.1
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis-SUMO2 (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GACGGGCAACCAATCAATGAAACAG
  • 3′ sequencing primer TATGCTAGTTATTGCTCAGCGGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pETSUMO2_Vitiosangium-bGSDM-thrombin was a gift from Philip Kranzusch (Addgene plasmid # 222099 ; http://n2t.net/addgene:222099 ; RRID:Addgene_222099)
  • For your References section:

    Structure and assembly of a bacterial gasdermin pore. Johnson AG, Mayer ML, Schaefer SL, McNamara-Bordewick NK, Hummer G, Kranzusch PJ. Nature. 2024 Apr;628(8008):657-663. doi: 10.1038/s41586-024-07216-3. Epub 2024 Mar 20. 10.1038/s41586-024-07216-3 PubMed 38509367