pETSUMO2_Ideonella-bGSDM-WELQ
(Plasmid
#222098)
-
PurposeFor expression of a mutant bacterial gasdermin (bGSDM) encoded by a Ideonella species with a WELQut protease cleavage site for controlled activation.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 222098 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepETSUMO2
- Total vector size (bp) 6736
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameIdeonella-bGSDM-WELQ ORF
-
SpeciesIdeonella sp. 201-F6
-
Insert Size (bp)795
-
MutationN-terminal methionine deleted and replaced by single serine scar after SUMO2 tag cleavage. WELQut protease site replacing residues A241–G245.
-
GenBank IDWP_157549374.1
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis-SUMO2 (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACGGGCAACCAATCAATGAAACAG
- 3′ sequencing primer TATGCTAGTTATTGCTCAGCGGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pETSUMO2_Ideonella-bGSDM-WELQ was a gift from Philip Kranzusch (Addgene plasmid # 222098 ; http://n2t.net/addgene:222098 ; RRID:Addgene_222098) -
For your References section:
Structure and assembly of a bacterial gasdermin pore. Johnson AG, Mayer ML, Schaefer SL, McNamara-Bordewick NK, Hummer G, Kranzusch PJ. Nature. 2024 Apr;628(8008):657-663. doi: 10.1038/s41586-024-07216-3. Epub 2024 Mar 20. 10.1038/s41586-024-07216-3 PubMed 38509367