pVP144
(Plasmid
#222081)
-
PurposeSingle component CRISPR-mediated base-editor for Agrobacterium genetic engineering visually marked with sfGFP for guide insertion and eforRED for plasmid eviction.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 222081 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepVP073
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsOriginally cloned in NEB-10beta cells
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9-PmCDA1, sfGFP, sacB and eforRED
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTATGATGAGAGCACCGATGAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byRodrigues et al., 2020 (doi.org/10.1073/pnas.2013338118)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
sfGFP and scaffold was amplified from: pEN-L1-PJ23119-Bsa1-PglpT-sfGFP-TrrfB-Bsa1-Scaf-L2.
sacB was amplified from: pEN-R2-SacB-L3.
The base editor expression unit was amplified from: pEN-L4-PvirB-dCas9-CDA-UL-T3T-R1.
eforRed was synthesized.
Please visit https://doi.org/10.1101/2024.08.04.606528 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVP144 was a gift from Wayne Parrott (Addgene plasmid # 222081 ; http://n2t.net/addgene:222081 ; RRID:Addgene_222081) -
For your References section:
Single component CRISPR-mediated base-editors for Agrobacterium and their use to develop an improved suite of strains. Pennetti VJ, LaFayette PR, Parrott WA. Biodes Res. 2025 March, 7:100001. doi: 10.1016/j.bidere.2025.100001 10.1016/j.bidere.2025.100001