TL1 alphaL_DdCBE 1-2-3 (right, DddA11-N)
(Plasmid
#221997)
-
PurposeExpresses mitochondrial cytosine base editor arm in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 221997 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 4717
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCOX8A MTS-3xFLAG-TALE NT-T-TL1 TALE repeats (alphaL-1/2/3 right)-TALE CTD-DddA11 1397N-UGI-ATP5B 3'UTR
-
SpeciesSynthetic
-
Insert Size (bp)3031
-
MutationDddA: S1330I, A1341V, N1342S, E1370K, T1380I
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on backbone)
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer T7
- 3′ sequencing primer ACACCCGCCGCGCTTAATGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
5' Cloning Site: BsmBI (Not Destroyed), 3' Cloning Site: BsmBI (Not Destroyed). Please visit https://www.biorxiv.org/content/10.1101/2024.05.13.593977v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TL1 alphaL_DdCBE 1-2-3 (right, DddA11-N) was a gift from Stephen Ekker (Addgene plasmid # 221997 ; http://n2t.net/addgene:221997 ; RRID:Addgene_221997) -
For your References section:
Unconstrained Precision Mitochondrial Genome Editing with alphaDdCBEs. Castillo SR, Simone BW, Clark KJ, Devaux P, Ekker SC. Hum Gene Ther. 2024 Sep 24. doi: 10.1089/hum.2024.073. 10.1089/hum.2024.073 PubMed 39212664