ATP6 DdCBE G2
(Plasmid #221951)

• Purpose: Expresses mitochondrial cytosine base editor arm in mammalian cells
• Depositing Lab: Stephen Ekker
• Publication: Castillo et al Hum Gene Ther. 2024 Sep 24. doi: 10.1089/hum.2024.073.

Backbone

• Vector backbone: pCMV
• Backbone size w/o insert (bp): 4717
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: COX8A MTS-3xFLAG-TALE NT-T-ATP6 TALE G2 repeats-TALE CTD-DddAtox 1397N-UGI-ATP5B 3'UTR
• Species: Synthetic
• Insert Size (bp): 2929
• Mutation: See depositor comments
• Promoter: CMV
• Tag / Fusion Protein:
  • 3xFLAG (N terminal on backbone)

Cloning Information

• Cloning method: Golden Gate
• 5′ sequencing primer: T7
• 3′ sequencing primer: ACACCCGCCGCGCTTAATGC

Resource Information

• Supplemental Documents:
  • ATP6 DdCBE G2.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene's NGS results found a mixed population of A/T nucleotides at position 2,840 that may result in a N646I mutation in the insert. This site defines the specificity of a DNA-binding protein for one 3’-terminal base within a 15-bp-long sequence. The mutation's effect on the affinity of the protein should be minimal.

5' Cloning Site: BsmBI (Not Destroyed), 3' Cloning Site: BsmBI (Not Destroyed). Please visit https://www.biorxiv.org/content/10.1101/2024.05.13.593977v1 for bioRxiv preprint.