Halo_aTubulin-pTwistCMVBetaGlobWPRENeo
(Plasmid
#221901)
-
PurposeExpresses Halo7 fused to alpha tubulin
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 221901 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTWIST_CMVBetaGlobWPRENeo
-
Backbone manufacturerTwist Biosciences
- Backbone size w/o insert (bp) 6788
- Total vector size (bp) 9071
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHalo7-aTubulin
-
SpeciesSynthetic
-
Insert Size (bp)2283
- Promoter CMV
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer ATGGAAATCGGTACTGGCTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Halo_aTubulin-pTwistCMVBetaGlobWPRENeo was a gift from Janelia Integrative Imaging (Addgene plasmid # 221901 ; http://n2t.net/addgene:221901 ; RRID:Addgene_221901)