Tol2-U6.3-sgRNA-non-targeting-control -GFP
(Plasmid #221844)

• Purpose: Tol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoter
• Depositing Lab: Stephen Terry
• Publication: O’Sullivan et al bioRxiv 2024.03.04.583298

Backbone

• Vector backbone: pTol2{Exp}
• Backbone manufacturer: vectorbuilder
• Backbone size w/o insert (bp): 3000
• Total vector size (bp): 5672
• Modifications to backbone: Chick U6.3 RNA promotor to express sgRNA and EGFP expressed from GACG promoter
• Vector type: Mammalian Expression, CRISPR ; Tol2 transposon optimised for chick expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: EGFP
• Insert Size (bp): 717
• Promoter: GACG

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: -

Gene/Insert 2

• Gene/Insert name: non-targeting control sgRNA- GCACTGCTACGATCTACACC
• Promoter: U6.3 chick

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: -

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2024.03.04.583298 for bioRxiv preprint.