Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Tol2-U6.3-sgRNA-non-targeting-control -GFP
(Plasmid #221844)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 221844 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTol2{Exp}
  • Backbone manufacturer
    vectorbuilder
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 5672
  • Modifications to backbone
    Chick U6.3 RNA promotor to express sgRNA and EGFP expressed from GACG promoter
  • Vector type
    Mammalian Expression, CRISPR ; Tol2 transposon optimised for chick expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    EGFP
  • Insert Size (bp)
    717
  • Promoter GACG

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    non-targeting control sgRNA- GCACTGCTACGATCTACACC
  • Promoter U6.3 chick

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer -
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.03.04.583298 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tol2-U6.3-sgRNA-non-targeting-control -GFP was a gift from Stephen Terry (Addgene plasmid # 221844 ; http://n2t.net/addgene:221844 ; RRID:Addgene_221844)
  • For your References section:

    Mitochondrial dynamics regulate cell size in the developing cochlea. O’Sullivan JDB, Terry S, Scott CA, Bullen A, Jagger DJ, Mann ZF. bioRxiv 2024.03.04.583298 10.1101/2024.03.04.583298