Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCMV:: PDGFR-Cry2olig-FRB-P2A-GFP(1-10)
(Plasmid #221776)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 221776 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSyc181 P2A
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pCMV:: PDGFR-Cry2olig-FRB-P2A-GFP(1-10)
  • Species
    Synthetic
  • Insert Size (bp)
    2836
  • Promoter CMV promoter

Cloning Information

  • Cloning method Other
  • 5′ sequencing primer GGACGTCGGAGCAAGCTTGATTTAGGTGACAC
  • 3′ sequencing primer ATAGGGAGGCTAGactaacttccgccgccacctgttcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV:: PDGFR-Cry2olig-FRB-P2A-GFP(1-10) was a gift from Dongmin Lee (Addgene plasmid # 221776 ; http://n2t.net/addgene:221776 ; RRID:Addgene_221776)
  • For your References section:

    A rationally designed optochemogenetic switch for activating canonical Wnt signaling. Lee S, Cui M, Lee D, Han K, Sun W, Lee D. iScience. 2023 Feb 19;26(3):106233. doi: 10.1016/j.isci.2023.106233. eCollection 2023 Mar 17. 10.1016/j.isci.2023.106233 PubMed 36915690