pCMV:: NES-FKBP-iLID-LRP6c(△1-64)
(Plasmid
#221775)
-
PurposeExpresses NES-FKBP-iLID-LRP6c(△1-64) component in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 221775 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSyc181 P2A
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepCMV:: NES-FKBP-iLID-LRP6c
-
SpeciesSynthetic
-
Insert Size (bp)1500
- Promoter CMV promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site NheI (unknown if destroyed)
- 5′ sequencing primer TCGGAGCAAGCTTGATTTAGGTGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV:: NES-FKBP-iLID-LRP6c(△1-64) was a gift from Dongmin Lee (Addgene plasmid # 221775 ; http://n2t.net/addgene:221775 ; RRID:Addgene_221775) -
For your References section:
A rationally designed optochemogenetic switch for activating canonical Wnt signaling. Lee S, Cui M, Lee D, Han K, Sun W, Lee D. iScience. 2023 Feb 19;26(3):106233. doi: 10.1016/j.isci.2023.106233. eCollection 2023 Mar 17. 10.1016/j.isci.2023.106233 PubMed 36915690