pSR1154
(Plasmid
#221653)
-
PurposeTetracycline sensor v3 for Staphylococcus aureus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 221653 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSR1002
- Backbone size w/o insert (bp) 4475
- Total vector size (bp) 6198
-
Modifications to backboneAdded TetR and sfGFP cassettes to detect output from tetracycline sensor
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Erythromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namesfGFP cassette
-
SpeciesSynthetic
-
Insert Size (bp)989
- Promoter PXyl-TetO
Cloning Information for Gene/Insert 1
- Cloning method Golden Gate
- 5′ sequencing primer aggcgattaaataagcaacatgaaca
- 3′ sequencing primer gcgtagaaaagggaaataggcg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTetR cassette
-
SpeciesSynthetic
-
Insert Size (bp)759
- Promoter PZwf
Cloning Information for Gene/Insert 2
- Cloning method Golden Gate
- 5′ sequencing primer catacacaagcaaaaatagcggtg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Low copy number replicon and erythromicin resistance in S. aureus
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSR1154 was a gift from Lauren Andrews (Addgene plasmid # 221653 ; http://n2t.net/addgene:221653 ; RRID:Addgene_221653) -
For your References section:
Toolbox of Characterized Genetic Parts for Staphylococcus aureus. Rondthaler SN, Sarker B, Howitz N, Shah I, Andrews LB. ACS Synth Biol. 2023 Dec 8. doi: 10.1021/acssynbio.3c00325. 10.1021/acssynbio.3c00325 PubMed 38064657