Skip to main content
Addgene

p8389 LentiCRISPRv2 Neo sgNT-1
(Plasmid #221649)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 221649 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLentiCRISPR v2
  • Backbone manufacturer
    Feng Zhang (Addgene #52961)
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    non-targeting sgNT-1
  • gRNA/shRNA sequence
    GAGCTCGCCATGTCGGTTCTC
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.03.07.583953 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p8389 LentiCRISPRv2 Neo sgNT-1 was a gift from Elizabeth White (Addgene plasmid # 221649 ; http://n2t.net/addgene:221649 ; RRID:Addgene_221649)
  • For your References section:

    HPV18 E7 inhibits LATS1 kinase and activates YAP1 by degrading PTPN14. Blakely WJ, Hatterschide J, White EA. mBio. 2024 Sep 9:e0181124. doi: 10.1128/mbio.01811-24. 10.1128/mbio.01811-24 PubMed 39248565