pPB-EF1A-Puro-mCherry-RAB7-S72A
(Plasmid
#221556)
-
PurposeExpresses Cherry-tagged human Rab7 with S72A mutation in mammalian cells. Compatible with piggybac transposase for genome integration.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 221556 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepPB
-
Backbone manufacturerVectorbuilder
-
Vector typeMammalian Expression ; piggybac
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRab7A
-
Alt nameRab7
-
SpeciesH. sapiens (human)
-
MutationChange serine 72 to alanine
-
Entrez GeneRAB7A (a.k.a. CMT2B, PRO2706, RAB7)
- Promoter EF1a
-
Tag
/ Fusion Protein
- mCherry (N terminal on backbone)
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPlasmid was custom synthesized by Vectorbuilder
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPB-EF1A-Puro-mCherry-RAB7-S72A was a gift from Shawn Ferguson (Addgene plasmid # 221556 ; http://n2t.net/addgene:221556 ; RRID:Addgene_221556) -
For your References section:
Lysosomal TBK1 Responds to Amino Acid Availability to Relieve Rab7-Dependent mTORC1 Inhibition. Talaia G, Bentley-DeSousa A, Ferguson SM. bioRxiv [Preprint]. 2023 Dec 17:2023.12.16.571979. doi: 10.1101/2023.12.16.571979. 10.1101/2023.12.16.571979 PubMed 38168426