pPB-EF1A-Puro-hTBK1-EGFP
(Plasmid #221553)

• Purpose: Expresses GFP-tagged human TBK1 in mammalian cells. Compatible with piggybac transposase for genome integration.
• Depositing Lab: Shawn Ferguson
• Publication: Talaia et al bioRxiv [Preprint]. 2023 Dec 17:2023.12.16.571979. doi: 10.1101/2023.12.16.571979.

Backbone

• Vector backbone: pPB
• Backbone manufacturer: Vectorbuilder
• Vector type: Mammalian Expression ; piggybac
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: TBK1
• Species: H. sapiens (human)
• Entrez Gene: TBK1 (a.k.a. FTDALS4, IIAE8, NAK, T2K)
• Promoter: EF1a
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Gene Synthesis
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC

Resource Information

• Supplemental Documents:
  • TBK1-GFP_piggybac.gb
• A portion of this plasmid was derived from a plasmid made by: Plasmid was custom synthesized by Vectorbuilder

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry