Skip to main content
Addgene

pSpCas9-2A-Puro-RAB7A-gRNA1 (PX459)
(Plasmid #221551)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 221551 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro (PX459) V2.0
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 62988)
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA targeting human Rab7A
  • gRNA/shRNA sequence
    GGTCATCCACCATCACCTCCT
  • Species
    H. sapiens (human)
  • Entrez Gene
    RAB7A (a.k.a. CMT2B, PRO2706, RAB7)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (unknown if destroyed)
  • 3′ cloning site BbsI (unknown if destroyed)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSpCas9-2A-Puro-RAB7A-gRNA1 (PX459) was a gift from Shawn Ferguson (Addgene plasmid # 221551 ; http://n2t.net/addgene:221551 ; RRID:Addgene_221551)

  • For your References section:

    Lysosomal TBK1 Responds to Amino Acid Availability to Relieve Rab7-Dependent mTORC1 Inhibition. Talaia G, Bentley-DeSousa A, Ferguson SM. bioRxiv [Preprint]. 2023 Dec 17:2023.12.16.571979. doi: 10.1101/2023.12.16.571979. 10.1101/2023.12.16.571979 PubMed 38168426
Related items: