pBB328
(Plasmid #221533)

• Purpose: Plasmid for the introduction of Mariner transposon that inserts deoxyviolacein cassette behind indigenous promoters in target bacterial strain. Plasmid has tetracycline marker for selection.
• Depositing Lab: Brett Barney
• Publication: A Deoxyviolacein-Based Transposon Insertion Vector for Pigmented Tracer Studies (unpublished)

Backbone

• Vector backbone: pBB298 (parent plasmid pEB001)
• Modifications to backbone: Minor modification through site-selective mutagenesis to pEB001 plasmid, which is a derivative of the pMiniHimar plasmid. Brutinel ED, Gralnick JA. 2012. Anomalies of the anaerobic tricarboxylic acid cycle in Shewanella oneidensis revealed by Tn-seq. Mol Microbiol 86:273–283.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Tetracycline, 10 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Escherichia coli BW25141 (for cloning)
• Growth instructions: Use WM3064 for conjugation
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: vioABCE
• Alt name: violacein operon segment from BBa_J72214-BBa_J72090
• Species: Synthetic
• Promoter: None, contains RBS site

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI/BglII (destroyed during cloning)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: GCTATCGTGACCTTGATAACGGCTGAC

Gene/Insert 2

• Gene/Insert name: Mariner transposase and transposon backbone from pBB298 (originally from pEB001)

Gene/Insert 3

• Gene/Insert name: Tetracycline antibiotic cassette from pRK415

Resource Information

• A portion of this plasmid was derived from a plasmid made by: violacein cassette comes from addgene BBa_J72214-BBa_J72090, transposase and backbone is from pEB001.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry