pcDNA5-FRT/T0-3XFLAG-NES-NFATC2IP
(Plasmid #221444)

• Purpose: Mammalian expression vector of triple Flag tagged NFATC2IP ORF with nuclear export signal (NES) at its N-terminus
• Depositing Lab: Daniel Durocher
• Publication: Cho et al Genes Dev. 2024 Apr 17;38(5-6):233-252. doi: 10.1101/gad.350914.123.

Backbone

• Vector backbone: pcDNA5-3X-Flag-FRT-T0
• Backbone manufacturer: ThermoFisher
• Backbone size w/o insert (bp): 5266
• Total vector size (bp): 6523
• Modifications to backbone: 1xFLAG was replaced by HindIII-3xFLAG-AscI, yielding 3xFLAG vector for N-terminal tagging with MCS
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NFATC2IP
• Species: H. sapiens (human)
• Insert Size (bp): 1257
• Mutation: NES (NLVDLQKKLEELELDEQQ)inserted, 1st Methionine of NFATC2IP deleted
• Entrez Gene: NFATC2IP (a.k.a. ESC2, NIP45, RAD60)
• Promoter: CMV
• Tags / Fusion Proteins:
  • 3XFlag (N terminal on insert)
  • Nuclear Export Signal (NES) (N terminal on insert)

Cloning Information

• Cloning method: Other
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg

Resource Information

• Supplemental Documents:
  • pcDNA5-FRT-TO-3xFLAG-NES-NFATC2IP delM.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA