pECFP_C1_NSD2 FL
(Plasmid #221382)

• Purpose: Expresses NSD2 in mammalian cells
• Depositing Lab: Albert Jeltsch
• Publication: Weirich et al Commun Biol. 2024 Jun 8;7(1):707. doi: 10.1038/s42003-024-06395-z.

Backbone

• Vector backbone: pECFP-C1
• Backbone size w/o insert (bp): 4734
• Total vector size (bp): 8829
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Histone-lysine N-methyltransferase NSD2
• Alt name: NSD2
• Species: H. sapiens (human)
• Insert Size (bp): 4095
• Mutation: L237R mutation in ECFP (Please see depositor comments)
• Entrez Gene: NSD2 (a.k.a. KMT3F, KMT3G, MMSET, RAUST, REIIBP, TRX5, WHS, WHSC1)
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CACATGGTCCTGCTGGAGTTCGT

Resource Information

• Supplemental Documents:
  • pECFP-C1 NSD2 FL WT.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The L237R mutation in ECFP did not affect expression of the fusion protein, fluorescence and binding of a GFP antibody, and is therefore not of relevance for the experiments conducted in the publication.