Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

shHIF2α(#2) (HIF2α-#2-pSUPER-retro-GFP/Neo)
(Plasmid #22131)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 22131 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSUPER_Retro-GFP/Neo
  • Backbone manufacturer
    OligoEngine
  • Backbone size w/o insert (bp) 7394
  • Vector type
    Mammalian Expression, Retroviral, RNAi
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5a or HB101
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    synthethic oligonucleotide
  • Insert Size (bp)
    58
  • Mutation
    synthethic oligonucleotide encoding shRNA targeting human HIF2alpha mRNA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl II (destroyed during cloning)
  • 3′ cloning site Hind III (not destroyed)
  • 5′ sequencing primer MSCV reverse
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

shRNA oligo sequence - 5'-GATCCCCGACAAGGTCTGCAAAGGGTTTCAAGAGAACCCTTTGCAGACCTTGTCTTTTT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    shHIF2α(#2) (HIF2α-#2-pSUPER-retro-GFP/Neo) was a gift from William Kaelin (Addgene plasmid # 22131 ; http://n2t.net/addgene:22131 ; RRID:Addgene_22131)
  • For your References section:

    Hypoxia-inducible factor linked to differential kidney cancer risk seen with type 2A and type 2B VHL mutations. Li L, Zhang L, Zhang X, Yan Q, Minamishima YA, Olumi AF, Mao M, Bartz S, Kaelin WG. Mol Cell Biol. 2007 Aug . 27(15):5381-92. 10.1128/MCB.00282-07 PubMed 17526729