U6-sgRNA(HEK3)-CMV-SpCas9(D10A)-P2A-EGFP
(Plasmid
#221233)
-
PurposeExpress sgRNA targeting HEK3 loci with nCas9(D10A)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 221233 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePX461
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpCas9(D10A)-P2A-EGFP
-
gRNA/shRNA sequenceGGCCCAGACTGAGCACGTGA
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Internal lab identifier DC562.
Please visit https://doi.org/10.1101/2024.02.01.577593 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
U6-sgRNA(HEK3)-CMV-SpCas9(D10A)-P2A-EGFP was a gift from Fei Chen (Addgene plasmid # 221233 ; http://n2t.net/addgene:221233 ; RRID:Addgene_221233) -
For your References section:
Helicase-assisted continuous editing for programmable mutagenesis of endogenous genomes. Chen XD, Chen Z, Wythes G, Zhang Y, Orr BC, Sun G, Thao K, Vallurupalli M, Sun J, Borji M, Tkacik E, Chen H, Bernstein BE, Chen F. bioRxiv 2024.02.01.577593 10.1101/2024.02.01.577593