pTE5419_p3WJdB-glcO36
(Plasmid
#221193)
-
PurposeGlcR module template with glcO36 operator: T7 promoDNA template of GlcR sensor with glcO36 operator: T7 promoter-glcO36-3WJdB reporter-T7 terminator linear DNA tter-glcO36-3WJdB reporter-T7 terminator
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 221193 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTE5417
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameT7 promoter-glcO36
-
Alt nameGlcR sensor template
-
SpeciesSynthetic
-
Insert Size (bp)68
- Promoter T7 promoter with downstream glcO36 operator
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer CGGTTCCTGGCCTTTTGC
- 3′ sequencing primer GATAGGTGCCTCACTGATTAAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.04.26.591264 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTE5419_p3WJdB-glcO36 was a gift from Tobias Erb (Addgene plasmid # 221193 ; http://n2t.net/addgene:221193 ; RRID:Addgene_221193) -
For your References section:
In vitro transcription-based biosensing of glycolate for prototyping of a complex enzyme cascade. Barthel S, Brenker L, Diehl C, Bohra N, Giaveri S, Paczia N, Erb TJ. Synthetic Biology, 2024;, ysae013 10.1093/synbio/ysae013