pTE5418_pMBP-GlcR
(Plasmid
#221192)
-
PurposeExpression vector for 10x-MBP-GlcR (MGlcR). GlcR is a glycolate-responsive transcriptional repressor and the gene product of pden4400 from Paracoccus denitrificans, codon optimized for E. coli.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 221192 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTE5400
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsE. coli BL21 AI works great as expression strain
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameglcR (pden4400 from Paracoccus denitrificans)
-
SpeciesParacoccus denitrificans
-
Insert Size (bp)847
-
GenBank IDABL72464.1
- Promoter T7 promoter-lacO
-
Tag
/ Fusion Protein
- 10x His tag with E. coli maltose binding protein (MBP) (N terminal on backbone)
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer GGTCGTCAGACTGTCGATG
- 3′ sequencing primer GAAGCCTGCATAACGCGAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.04.26.591264 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTE5418_pMBP-GlcR was a gift from Tobias Erb (Addgene plasmid # 221192 ; http://n2t.net/addgene:221192 ; RRID:Addgene_221192) -
For your References section:
In vitro transcription-based biosensing of glycolate for prototyping of a complex enzyme cascade. Barthel S, Brenker L, Diehl C, Bohra N, Giaveri S, Paczia N, Erb TJ. Synthetic Biology, 2024;, ysae013 10.1093/synbio/ysae013