Skip to main content
Addgene

pTE5417_p3WJdB_promoter dropout vector
(Plasmid #221191)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 221191 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAmp/ColE1
  • Backbone size (bp) 2109
  • Modifications to backbone
    added a 3WJdB reporter with T7 terminator under the control of a promoter placeholder/dropout site (see Marburg Collection)
  • Vector type
    Synthetic Biology
  • Promoter Promoter Placeholder/Dropout Vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer CGGTTCCTGGCCTTTTGC
  • 3′ sequencing primer GATAGGTGCCTCACTGATTAAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For details on placeholder/dropout sequences see Stukenberg et al.: https://doi.org/10.1021/acssynbio.1c00126.

Please visit https://doi.org/10.1101/2024.04.26.591264 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTE5417_p3WJdB_promoter dropout vector was a gift from Tobias Erb (Addgene plasmid # 221191 ; http://n2t.net/addgene:221191 ; RRID:Addgene_221191)
  • For your References section:

    In vitro transcription-based biosensing of glycolate for prototyping of a complex enzyme cascade. Barthel S, Brenker L, Diehl C, Bohra N, Giaveri S, Paczia N, Erb TJ. Synthetic Biology, 2024;, ysae013 10.1093/synbio/ysae013