Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pQFmcs-2H12.D11-scarREF
(Plasmid #221184)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 221184 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pQFmcs
  • Backbone manufacturer
    Andreas Kaczmarczyk
  • Backbone size w/o insert (bp) 7300
  • Total vector size (bp) 9300
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    cdGreen2
  • Alt name
    2H12.D11
  • Species
    Synthetic
  • Insert Size (bp)
    1300
  • Promoter PQ5 (cumate-inducible)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer 10572 (TACATATGTCAATGTACCGG)
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mScarlet-I
  • Species
    Synthetic
  • Insert Size (bp)
    700
  • Mutation
    N-terminus changed: starts with MSKKYGEAVIKE ...
  • Promoter None (same as cdGreen2)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site NheI/SpeI (destroyed during cloning)
  • 5′ sequencing primer NA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQFmcs-2H12.D11-scarREF was a gift from Urs Jenal (Addgene plasmid # 221184 ; http://n2t.net/addgene:221184 ; RRID:Addgene_221184)
  • For your References section:

    A genetically encoded biosensor to monitor dynamic changes of c-di-GMP with high temporal resolution. Kaczmarczyk A, van Vliet S, Jakob RP, Teixeira RD, Scheidat I, Reinders A, Klotz A, Maier T, Jenal U. Nat Commun. 2024 May 9;15(1):3920. doi: 10.1038/s41467-024-48295-0. 10.1038/s41467-024-48295-0 PubMed 38724508