CUP1-∆ssCPY*-mScarletI in pRS315
(Plasmid
#221159)
-
PurposeFluorescent reporter for cytoplasmic aggregates under LEU2 selection marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 221159 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRS315
- Backbone size w/o insert (bp) 5937
- Total vector size (bp) 8892
-
Vector typeYeast Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCarboxypeptidase Y
-
Alt name∆ssCPY*
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1536
-
MutationDeletion signal peptide, G255A mutation
-
Entrez GenePRC1 (a.k.a. YMR297W, CPY1, LBC1)
-
Tag
/ Fusion Protein
- mScarletI
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgtatcaattgcattataatatcttcttgt
- 3′ sequencing primer aactaattacatgatatcgacaaaggaaaa (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CUP1-∆ssCPY*-mScarletI in pRS315 was a gift from Mark Leake (Addgene plasmid # 221159 ; http://n2t.net/addgene:221159 ; RRID:Addgene_221159)