pCB-CBEv2
(Plasmid #221139)

• Purpose: Coxiella burnetii CRISPR-Cas9 cytosine base editing plasmid version 2 without sgRNA construct. Expresses 3xF-BE4-PpAPOBEC1(H122A).
• Depositing Lab: Craig Roy
• Publication: Steiner et al mSphere. 2024 Nov 19:e0052324. doi: 10.1128/msphere.00523-24.

Backbone

• Vector backbone: pMTX808
• Backbone manufacturer: Matxalen Llosa lab
• Total vector size (bp): 16524
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: 3xF-PpAPOBEC1(H122A)-Cas9n-UGI-UGI (BE4-PpAPOBEC1(H122A))
• Species: Synthetic
• Promoter: lacIq-Ptac
• Tag / Fusion Protein:
  • 3xFLAG (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TTGAAAAATTGCCTACTGAGCGCTG

Resource Information

• Supplemental Documents:
  • pCB-CBEv2.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

RSF1010-based plasmid. Expresses 3xF-BE4-PpAPOBEC1(H122A) from lacIq-Ptac promoter. IPTG induction is required for base editing in Coxiella burnetii. Unique XhoI, NotI and SapI sites for addition of sgRNA-encoding region(s) from pHelper-CBE-sgRNA (Addgene plasmid #221137) helper plasmid derivatives. Plasmid harbors oriT, but relaxase gene mobA is interrupted by AmpR. Plasmid encodes sacB, but sacB is not required for Coxiella burnetii base editing protocol. Plasmid alias: pSAST372.