pCB-CBEv1
(Plasmid #221138)

• Purpose: Coxiella burnetii CRISPR-Cas9 cytosine base editing plasmid version 1 without sgRNA construct. Expresses 3xF-HF-BE3.
• Depositing Lab: Craig Roy
• Publication: Steiner et al mSphere. 2024 Nov 19:e0052324. doi: 10.1128/msphere.00523-24.

Backbone

• Vector backbone: pMTX808
• Backbone manufacturer: Matxalen Llosa lab
• Total vector size (bp): 14716
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: 3xF-rAPOBEC1-Cas9n(HF)-UGI (HF-BE3)
• Species: Synthetic
• Promoter: lacIq-Ptac
• Tag / Fusion Protein:
  • 3xFLAG (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TTGAAAAATTGCCTACTGAGCGCTG

Resource Information

• Supplemental Documents:
  • pCB-CBEv1.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

RSF1010-based plasmid. Expresses 3xF-HF-BE3 from lacIq-Ptac promoter. Basal expression is sufficient for base editing in Coxiella burnetii. Note: During growth of E. coli harboring this plasmid, in some cells/colonies, the basal expression of 3xF-HF-BE3 can lead to spurious deamination of cytosines on the plasmid.

Unique XhoI, NotI and XbaI sites for addition of sgRNA-encoding region(s) from pHelper-CBE-sgRNA (Addgene plasmid #221137) helper plasmid derivatives. Plasmid harbors oriT, but relaxase gene mobA is interrupted by AmpR. Plasmid alias: pSAST356.