pCB-CRISPRi
(Plasmid
#221136)
-
PurposeCoxiella burnetii CRISPRi plasmid without sgRNA construct. Expresses 3xF-dCas9.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 221136 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJB-KAN-3xFLAG
-
Backbone manufacturerRobert Heinzen lab
- Total vector size (bp) 14077
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name3xF-dCas9
-
SpeciesSynthetic
- Promoter cbu1169 promoter
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GAGCGGATAACAATTTCACACAGG
- 3′ sequencing primer TGCTTTACGGTATCGCCGCTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
RSF1010-based plasmid. Expresses 3xF-dCas9 from cbu1169 promoter. Unique XhoI, NotI and EcoRI sites for addition of sgRNA-encoding region(s) from pHelper-CRISPRi-sgRNA (Addgene plasmid #221135) helper plasmid derivatives. Plasmid alias: pSAST200.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCB-CRISPRi was a gift from Craig Roy (Addgene plasmid # 221136 ; http://n2t.net/addgene:221136 ; RRID:Addgene_221136) -
For your References section:
CRISPR-Cas9-based approaches for genetic analysis and epistatic interaction studies in Coxiella burnetii. Steiner S, Roy CR. mSphere. 2024 Nov 19:e0052324. doi: 10.1128/msphere.00523-24. 10.1128/msphere.00523-24 PubMed 39560384