pHelper-CRISPRi-sgRNA
(Plasmid
#221135)
-
PurposeHelper plasmid for sgRNA cloning for CRISPRi. sgRNA-scaffold with dCas9 handle expressed from constitutive bacterial promoter J23119(SpeI). 2 BbsI sites for sgRNA cloning.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 221135 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech/Takara
- Total vector size (bp) 4924
-
Vector typeBacterial Expression, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA-scaffold with dCas9 handle
-
SpeciesSynthetic
- Promoter J23119(SpeI)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
XhoI/NotI and EcoRI sites for subcloning of sgRNA-encoding region to pCB-CRISPRi (Addgene plasmid #221136). Plasmid alias: pSAST163.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHelper-CRISPRi-sgRNA was a gift from Craig Roy (Addgene plasmid # 221135 ; http://n2t.net/addgene:221135 ; RRID:Addgene_221135) -
For your References section:
CRISPR-Cas9-based approaches for genetic analysis and epistatic interaction studies in Coxiella burnetii. Steiner S, Roy CR. mSphere. 2024 Nov 19:e0052324. doi: 10.1128/msphere.00523-24. 10.1128/msphere.00523-24 PubMed 39560384