pFSKm4-ATF1
(Plasmid
#221133)
-
PurposeFormaldehyde sensor based on the frmR repressor, which expresses yeast alcohol acetyl transferase (ATF1) upon detection
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 221133 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTR47m4
- Backbone size w/o insert (bp) 3716
- Total vector size (bp) 5329
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameATF1
-
Alt nameAlcohol acetyltransferase I
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1613
-
Entrez GeneATF1 (a.k.a. YOR377W)
- Promoter Pm4
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACTGTCAAGAGGACATCCGG
- 3′ sequencing primer GTGAGCCAGTGTGACTCTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byJaroslaw Bryk and Gregory Stephanopoulos. The ATF1 gene was cloned from p006-Banana-Late (Addgene Plasmid #112251). The backbone was cloned from pTR47m4-GFP (Addgene plasmid #102436)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFSKm4-ATF1 was a gift from André Studart (Addgene plasmid # 221133 ; http://n2t.net/addgene:221133 ; RRID:Addgene_221133) -
For your References section:
Living Porous Ceramics for Bacteria-Regulated Gas Sensing and Carbon Capture. Dutto A, Kan A, Saraw Z, Maillard A, Zindel D, Studart AR. Adv Mater. 2024 Dec 10:e2412555. doi: 10.1002/adma.202412555. 10.1002/adma.202412555 PubMed 39659127