polySIM
(Plasmid
#221068)
-
PurposeExpression of polySIM protein under T7 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 221068 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneUnknown
- Backbone size w/o insert (bp) 6000
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name10 repeats of SUMO interacting motif (SIM) from PIASx each separated by (GGS)4
-
SpeciesH. sapiens (human)
- Promoter unknown
-
Tags
/ Fusion Proteins
- MBP (N terminal on insert)
- His (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgenePlasmid #126946, Salman Banani
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
polySIM was a gift from Michael Rosen (Addgene plasmid # 221068 ; http://n2t.net/addgene:221068 ; RRID:Addgene_221068) -
For your References section:
Surface Charge Can Modulate Phase Separation of Multidomain Proteins. Kim J, Qin S, Zhou HX, Rosen MK. J Am Chem Soc. 2024 Feb 7;146(5):3383-3395. doi: 10.1021/jacs.3c12789. Epub 2024 Jan 23. 10.1021/jacs.3c12789 PubMed 38262618