pMMS22L-siR3
(Plasmid
#221013)
-
Purposemammalian expression vector of myc-Flag tagged MMS22L siRNA resistant
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 221013 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepCMV6-Entry
-
Backbone manufacturerOrigene
- Backbone size w/o insert (bp) 4880
- Total vector size (bp) 8610
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)CopyCutter
-
Growth instructionsEXTREMELY UNSTABLE IN BACTERIA. Must be propagated in CopyCutter EPI400 E. coli cells. See additional instructions. It is recommended to sequence entire ORF after each prep.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMMS22L
-
Alt nameC16orf167
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3730
-
Mutationsilent mutations MMS22L: 5'-aaAacGtgTtgCtgTgaC-3' to confer siRNA resistance
-
GenBank IDNM_198468.2
-
Entrez GeneMMS22L (a.k.a. C6orf167, dJ39B17.2)
- Promoter CMV
-
Tags
/ Fusion Proteins
- myc (C terminal on backbone)
- Flag (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer cgcaaatgggcggtaggcgtg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMMS22L-siR3 was a gift from Daniel Durocher (Addgene plasmid # 221013 ; http://n2t.net/addgene:221013 ; RRID:Addgene_221013) -
For your References section:
The MMS22L-TONSL complex mediates recovery from replication stress and homologous recombination. O'Donnell L, Panier S, Wildenhain J, Tkach JM, Al-Hakim A, Landry MC, Escribano-Diaz C, Szilard RK, Young JT, Munro M, Canny MD, Kolas NK, Zhang W, Harding SM, Ylanko J, Mendez M, Mullin M, Sun T, Habermann B, Datti A, Bristow RG, Gingras AC, Tyers MD, Brown GW, Durocher D. Mol Cell. 2010 Nov 24;40(4):619-31. doi: 10.1016/j.molcel.2010.10.024. Epub 2010 Nov 4. 10.1016/j.molcel.2010.10.024 PubMed 21055983