Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDNA5-FRT/TO-FLAG-TONSL
(Plasmid #221011)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 221011 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA5 Flag-FRT-T0
  • Backbone manufacturer
    ThermoFisher
  • Backbone size w/o insert (bp) 5129
  • Total vector size (bp) 9263
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin, Zeocin, Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TONSL
  • Alt name
    NFKBIL2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4134
  • Mutation
    silent mutations in TONSL: 5’-gaATtAgaTCtaTCGatga-3’ to confer siRNA resistance
  • GenBank ID
    NM_013432.4
  • Entrez Gene
    TONSL (a.k.a. IKBR, NFKBIL2, SEMDSP)
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDNA5-FRT/TO-FLAG-TONSL was a gift from Daniel Durocher (Addgene plasmid # 221011 ; http://n2t.net/addgene:221011 ; RRID:Addgene_221011)
  • For your References section:

    The MMS22L-TONSL complex mediates recovery from replication stress and homologous recombination. O'Donnell L, Panier S, Wildenhain J, Tkach JM, Al-Hakim A, Landry MC, Escribano-Diaz C, Szilard RK, Young JT, Munro M, Canny MD, Kolas NK, Zhang W, Harding SM, Ylanko J, Mendez M, Mullin M, Sun T, Habermann B, Datti A, Bristow RG, Gingras AC, Tyers MD, Brown GW, Durocher D. Mol Cell. 2010 Nov 24;40(4):619-31. doi: 10.1016/j.molcel.2010.10.024. Epub 2010 Nov 4. 10.1016/j.molcel.2010.10.024 PubMed 21055983