Src(YF)-SsrA(Y7I)-mCer3
(Plasmid
#220999)
-
Purposethis is microTag (Y7I mutation in SsrA)-Src(Y529F) with mCerulean3 at C-terminal
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 220999 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSrc, SsrA, mCerulean3
-
SpeciesM. musculus (mouse)
-
MutationY529F in Src, Y7I in SsrA
-
Entrez GeneSrc (a.k.a. pp60c-src)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCerulean3 (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Src(YF)-SsrA(Y7I)-mCer3 was a gift from Klaus Hahn (Addgene plasmid # 220999 ; http://n2t.net/addgene:220999 ; RRID:Addgene_220999) -
For your References section:
Biosensors based on peptide exposure show single molecule conformations in live cells. Liu B, Stone OJ, Pablo M, Herron JC, Nogueira AT, Dagliyan O, Grimm JB, Lavis LD, Elston TC, Hahn KM. Cell. 2021 Oct 28;184(22):5670-5685.e23. doi: 10.1016/j.cell.2021.09.026. Epub 2021 Oct 11. 10.1016/j.cell.2021.09.026 PubMed 34637702