eScaf
(Bacterial strain
#220921)
-
PurposecssDNA production strain
-
Depositing Lab
-
Sequence Information
-
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Bacterial Strain | 220921 | Bacteria in agar stab | 1 | $85 |
Backbone
-
Vector backbonen/a
Growth in Bacteria
-
Bacterial Resistance(s)None
-
Growth Temperature30°C
-
Growth Strain(s)eScaf
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGenotype: F’[traD36 lacIq lacZ ∆M15 proA+B+] glnV (supE) thi-1 ∆(mcrB-hsdSM)5 (rK- mK- McrB-) ∆(lac-proAB) ulaD::M13
-
SpeciesE. coli
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Primers for validation
Pair 1: agtaaggacgcgccatgaaa + agcgaaagacagcatcggaa (Ta = 59 C, should have 2526 bp product)
Pair 2: aatcggttgaatgtcgccct + gggaaacgacgatgagcaga (Ta = 59, should have 3900 bp product)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
eScaf was a gift from Shawn Douglas (Addgene plasmid # 220921) -
For your References section:
Engineering an Escherichia coli strain for production of long single-stranded DNA. Shen K, Flood JJ, Zhang Z, Ha A, Shy BR, Dueber JE, Douglas SM. Nucleic Acids Res. 2024 Apr 24;52(7):4098-4107. doi: 10.1093/nar/gkae189. 10.1093/nar/gkae189 PubMed 38499480