Addgene: eScaf Skip to main content
Addgene

eScaf
(Bacterial strain #220921)

Full plasmid sequence is not available for this item.

No maps are available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Bacterial Strain 220921 Bacteria in agar stab 1 $85

Backbone

  • Vector backbone
    n/a

Growth in Bacteria

  • Bacterial Resistance(s)
    None
  • Growth Temperature
    30°C
  • Growth Strain(s)
    eScaf
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Genotype: F’[traD36 lacIq lacZ ∆M15 proA+B+] glnV (supE) thi-1 ∆(mcrB-hsdSM)5 (rK- mK- McrB-) ∆(lac-proAB) ulaD::M13
  • Species
    E. coli

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Primers for validation
Pair 1: agtaaggacgcgccatgaaa + agcgaaagacagcatcggaa (Ta = 59 C, should have 2526 bp product)
Pair 2: aatcggttgaatgtcgccct + gggaaacgacgatgagcaga (Ta = 59, should have 3900 bp product)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    eScaf was a gift from Shawn Douglas (Addgene plasmid # 220921)
  • For your References section:

    Engineering an Escherichia coli strain for production of long single-stranded DNA. Shen K, Flood JJ, Zhang Z, Ha A, Shy BR, Dueber JE, Douglas SM. Nucleic Acids Res. 2024 Apr 24;52(7):4098-4107. doi: 10.1093/nar/gkae189. 10.1093/nar/gkae189 PubMed 38499480