CD55-full length
(Plasmid #220874)

• Purpose: Expresses CD55 variant in mammalian cells
• Depositing Lab: Ferenc Scheeren
• Publication: CRISPR/Cas9 screening reveals a distinct class of pMHC-I binders with precise HLA-peptide recognition (unpublished)

Backbone

• Vector backbone: mEGFP-C1
• Backbone size w/o insert (bp): 4712
• Total vector size (bp): 6427
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CD55
• Species: H. sapiens (human)
• Insert Size (bp): 1146
• Entrez Gene: CD55 (a.k.a. CHAPLE, CR, CROM, DAF, TC)
• Promoter: CMW
• Tag / Fusion Protein:
  • EGFP (C terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GCATTCCTTTGGCGAGAG

Resource Information

• Supplemental Documents:
  • CD55 IRES mGFP FL.gbk
• A portion of this plasmid was derived from a plasmid made by: ORFeome collection library from Horizon Discovery

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry