Skip to main content
Addgene

CD55-Delta3
(Plasmid #220872)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 220872 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    mEGFP-C1
  • Backbone size w/o insert (bp) 4712
  • Total vector size (bp) 5866
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD55 Delta-3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    585
  • Mutation
    Delta-3, short consensus repeat (SCR) domains 1, 2 and 3 are deleted: amino acids (35 to 221)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GCATTCCTTTGGCGAGAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    ORFeome collection library from Horizon Discovery

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CD55-Delta3 was a gift from Ferenc Scheeren (Addgene plasmid # 220872 ; http://n2t.net/addgene:220872 ; RRID:Addgene_220872)