CD55-Delta2
(Plasmid
#220871)
-
PurposeExpresses CD55 variant in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 220871 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonemEGFP-C1
- Backbone size w/o insert (bp) 4712
- Total vector size (bp) 6049
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCD55 Delta-2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)768
-
MutationDelta-2, short consensus repeat (SCR) domains 1 and 2 are deleted: amino acids (35 to 160)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GCATTCCTTTGGCGAGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byORFeome collection library from Horizon Discovery
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CD55-Delta2 was a gift from Ferenc Scheeren (Addgene plasmid # 220871 ; http://n2t.net/addgene:220871 ; RRID:Addgene_220871)