Skip to main content
Addgene

pTMB352_ZFcharm_Kv1_split-inteins
(Plasmid #220848)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 220848 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Lentiviral expression plasmid
  • Backbone size w/o insert (bp) 7856
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ZFcharm Kv2
  • Species
    H. sapiens (human); Apodemus sylvaticus
  • Insert Size (bp)
    3999
  • Mutation
    N/A
  • Promoter EFS
  • Tag / Fusion Protein
    • P2A-mCherry (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctgggaaagtgatgtcgtgtac
  • 3′ sequencing primer ctttaagaccaatgacttacaaggcagctgt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTMB352_ZFcharm_Kv1_split-inteins was a gift from Jonathan Weissman (Addgene plasmid # 220848 ; http://n2t.net/addgene:220848 ; RRID:Addgene_220848)
  • For your References section:

    Brainwide silencing of prion protein by AAV-mediated delivery of an engineered compact epigenetic editor. Neumann EN, Bertozzi TM, Wu E, Serack F, Harvey JW, Brauer PP, Pirtle CP, Coffey A, Howard M, Kamath N, Lenz K, Guzman K, Raymond MH, Khalil AS, Deverman BE, Minikel EV, Vallabh SM, Weissman JS. Science. 2024 Jun 28;384(6703):ado7082. doi: 10.1126/science.ado7082. Epub 2024 Jun 28. 10.1126/science.ado7082 PubMed 38935715