pTMB340_ZFcharm_Kv1_Prnp_DPM
(Plasmid
#220843)
-
PurposeAAV genome expressing ZFcharm Kv1 targeting Prnp; double perfect match self-silencing binding site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 220843 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV expression plasmid
- Backbone size w/o insert (bp) 4608
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZFcharm Kv1
-
SpeciesH. sapiens (human); Apodemus sylvaticus
-
Insert Size (bp)2070
-
MutationN/A
- Promoter EFS
-
Tag
/ Fusion Protein
- HAtag (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctgggaaagtgatgtcgtgtac
- 3′ sequencing primer ggatacgctgctttaatgcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTMB340_ZFcharm_Kv1_Prnp_DPM was a gift from Jonathan Weissman (Addgene plasmid # 220843 ; http://n2t.net/addgene:220843 ; RRID:Addgene_220843) -
For your References section:
Brainwide silencing of prion protein by AAV-mediated delivery of an engineered compact epigenetic editor. Neumann EN, Bertozzi TM, Wu E, Serack F, Harvey JW, Brauer PP, Pirtle CP, Coffey A, Howard M, Kamath N, Lenz K, Guzman K, Raymond MH, Khalil AS, Deverman BE, Minikel EV, Vallabh SM, Weissman JS. Science. 2024 Jun 28;384(6703):ado7082. doi: 10.1126/science.ado7082. Epub 2024 Jun 28. 10.1126/science.ado7082 PubMed 38935715